Texas Grass Tubeworm

November 21, 2022

Sample information
Picture
Photos by: Lucy K., Stella T.
Location
Collection date 07/21/2022
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

We weren’t the ones who collected the arthropod, so we aren’t sure the circumstances under which it was caught.
Putative identification Arthropoda Hexapoda Insecta Lepidoptera

Methods
Extraction kit DNeasy (Qiagen)
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA extraction: The whole moth was used.

Gel electrophoresis lanes:

Lane 1: 10kb DNA Ladder
Lane 2: Arthropod Sample A-1
Lane 3: Arthropod Sample A-2
Lane 4: Arthropod Sample A-3
Lane 5: Arthropod Sample A-4
Lane 6: Positive Arthropod Control
Lane 7: Negative Arthropod Control
Lane 8: Positive DNA Control
Lane 9: Water

Analysis:

We know the results for the arthropod and Wolbachia tests for the A-4 sample are reliable because the sample tested positive for arthropod DNA and the results have no contamination because our controls tested correctly.

Results
Wolbachia presence No
Confidence level Medium
Explanation of confidence level

The sample tested negative for Wolbachia. Our confidence level is medium. There is a small chance that our results aren’t all completely accurate, because there was an error with our A-2 sample during one of our procedures that resulted in it testing negative for the CO1 gene. Even though the A-2 sample was cut from our results, it still goes to show that human error is always possible.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
ATATTAGGAACTTCTTTGAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTA TAATACAATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTTCCTTTAATACTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTATTACCCCCA TCATTAACTTTATTAATTTCAAGAAGAATTGTCGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCCCTATCTTC TAACATTGCTCACGGAGGTGGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCCTCAATTCTAGGAG CTGTAAATTTTATTACAACAGTAATTAATATACGGACCATTGGAATATCCTTTGATCGTATACCTTTATTTGTTTGATCT GTAGCAATTAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lepidoptera was found to be negative for Wolbachia.
Report Inappropriate Post