Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/11/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Penn State Lehigh Valley |
| Observations |
|
| Putative identification | Arthropoda Insecta Hemiptera Pentatomidae Euschistus Euschistus tristigmus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Green |
| Gel images |
|
| Protocol notes | Procedure for Casting Gels and Loading Samples Gel results are read from lane 1 (bottom-most lane) to lane 8 (top most lane). The results pertinent to this entry (Stinkbug) are in LANE 3. Lane 1: DNA Ladder Lane 2: Arthropod 1 (Wol + COI1) Lane 3: Arthropod 2 (Wol + COI1, Stinkbug Pertinent to THIS entry) Lane 4: Wol Pos Wol + COI1 Lane 5: Wol Neg Wol + COI1 Lane 6: gDNA control Wol + COI1 Lane 7: water control Wol + COI1 Lane 8: EMPTY |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The confidence level is high as the controls resulted in expected outcomes. Both Wolbachia controls (Lanes 4 and 5) have the Wolbachia band present and not present, respectively. Additionally, the DNA control bands (Lanes 6 and 7) are present and missing, respectively. Finally, the third control (Lane 8) has no band present at all. Taken all together, this confirms that no cross contamination likely occurred, technique of extraction, PCR, and gel electrophoresis was performed adequately. Therefore, the results for the entry-documented arthropod (Lane 3) are assumed to be accurate. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
GAGCAGGATAGTGGGGTCCGCTATAAGAATTATTATTCGTATTGAATTAGGACAACCAGGA AGATTTATTGGAGATGATCAAATCTATAATGTTGTAGTTACTGCTCACGCATTCGTTATAATTTTTTTTATAGTAATACC AATTATAATTGGAGGATTTGGTAACTGACTAGTGCCATTAATAATTGGAGCTCCTGATATAGCATTCCCTCGAATAAATA ATATAAGATTCTGATTATTACCCCCTTCAATTACTTTATTAATAATAAGTAGATTAGCTGAATCAGGGGCTGGAACCGGC TGAACTGTATACCCCCCACTATCAAGTAATCTATCCCACAGAGGAGCATCAGTAGACTTGGCTATCTTTTCCTTACACTT AGCAGGTGTTTCTTCAATTCTAGGAGCTGTAAATTTCATTTCAACAATTATAAATATACGACCCGAAGGAATAATCCCAG AACGAATCCCCTTATTCGTATGATCAGTAGGAATTACAGCACTATTATTACTACTTTCCCTTCCCGTATTAGCAGGAGCT ATTACTATATTATTAACCGATCGCAACTTTAATACATCCTTCTTTGATCCTTCAGGAGGAGGGGATCCTATCTTGTATCA ACATCTATTCTGATTTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Euschistus tristigmus was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis