Sample information |
|
| Picture |
|
|---|---|
| Location | Approximate location: 40.62, -74.57 |
| Collection date | 05/26/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Black ant; about 5mm; 6 legs; redish colored legs and antennae; hairs on body; head, thorax, and abdomen are shiny black; fast runner. The common name for the ant is a black field ant. I found the ant in the “backyard” of a school at a clearing before the entrance to the woods. The ant was collected in late May, the temperature was 20.556ยบ C, it was sunny, and the ant was crawling across a patch of dry dirt among some weeds and grass. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Formica Formica subsericea |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | DNA extraction: I simply mashed the entire bug to collect the abdomen DNA PCR: I made a mistake during PCR because I pipetted too much “PCR cocktail” into one of the PCR tubes (not sure which) and didn’t have enough cocktail for the Wolbachia control (it is omitted from the gel). Gel electrophoresis lanes for the image above:
Analysis: The ants had very strong bands, but the controls did not work as expected. Additionally, the wolbachia side of the gel has faint bands at the arthropod bp location. Sequencing: Unfortunately, my wolbachia sequencing sample dried up and was unable to be sequenced. Only the arthropod sample was sequenced, resulting in an average Q-value of 39. When I “blastn” and “blastx” the sequence, I got my type of arthropod. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | I am somewhat confident my ant is wolbachia positive because although the band is extremely bright at the wolbachia base-pair location on the gel (comparing with the DNA ladder), the negative wolbachia control bug had a faint band at the wolbachia base-pair location. So, I’m not completely confident in my results but I am fairly confident. Additionally, my wolbachia sample was unable to be sequenced, so I don’t actually know for sure if my ant had wolbachia. Nevertheless, the highlighted bands give me confidence in my results. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AATTAGGCTCATCTAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATT TTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATACTAGGATCACCAGACATAGC ATACCCTCGTATAAATAATATAAGATTTTGACTCTTACCTCCTTCAATTACTCTTTTACTTTTAAGAAATTTTATTAATG ACGGAACAGGAACAGGATGAACTATTTATCCTCCCTTATCCTCTAATATTTTTCATAATGGTCCTTCTGTAGACTTAACA ATTTTTTCTCTTCATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCA TAAAAATTTTTCTATTGATAAAATTCCTTTGCTCGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTAC CTGTATTAGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Formica subsericea was found to be postive for Wolbachia. |


Millipede
Brown Widow
(no title)
Texas Carpenter Ant
Boxelder Bug (Hemiptera)