Formica subsericea

Sample information

Picture
Entry by: Francesca Z.
Location
Approximate location: 40.62, -74.57
Collection date 05/26/2022
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

Black ant; about 5mm; 6 legs; redish colored legs and antennae; hairs on body; head, thorax, and abdomen are shiny black; fast runner. The common name for the ant is a black field ant.

I found the ant in the “backyard” of a school at a clearing before the entrance to the woods. The ant was collected in late May, the temperature was 20.556ยบ C, it was sunny, and the ant was crawling across a patch of dry dirt among some weeds and grass.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Formica Formica subsericea

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

DNA extraction: I simply mashed the entire bug to collect the abdomen DNA

PCR: I made a mistake during PCR because I pipetted too much “PCR cocktail” into one of the PCR tubes (not sure which) and didn’t have enough cocktail for the Wolbachia control (it is omitted from the gel).

Gel electrophoresis lanes for the image above:

  1. DNA ladder 1
  2. My ant tested for CO1 arthropod gene
  3. My lab partner’s ant tested for CO1 arthropod gene
  4. Positive arthropod control
  5. Negative arthropod control
  6. Blank (was supposed to be positive wolbachia dna control)
  7. DNA water control
  8. Break
  9. My ant tested for wolbachia dna
  10. My lab partner’s ant tested for wolbachia dna
  11. Positive arthropod control
  12. Negative arthropod control
  13. Positive wolbachia control
  14. Water control
  15. DNA ladder 2

Analysis:

The ants had very strong bands, but the controls did not work as expected. Additionally, the wolbachia side of the gel has faint bands at the arthropod bp location.

Sequencing: Unfortunately, my wolbachia sequencing sample dried up and was unable to be sequenced. Only the arthropod sample was sequenced, resulting in an average Q-value of 39. When I “blastn” and “blastx” the sequence, I got my type of arthropod.

Results

Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

I am somewhat confident my ant is wolbachia positive because although the band is extremely bright at the wolbachia base-pair location on the gel (comparing with the DNA ladder), the negative wolbachia control bug had a faint band at the wolbachia base-pair location. So, I’m not completely confident in my results but I am fairly confident. Additionally, my wolbachia sample was unable to be sequenced, so I don’t actually know for sure if my ant had wolbachia. Nevertheless, the highlighted bands give me confidence in my results.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AATTAGGCTCATCTAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATT TTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATACTAGGATCACCAGACATAGC ATACCCTCGTATAAATAATATAAGATTTTGACTCTTACCTCCTTCAATTACTCTTTTACTTTTAAGAAATTTTATTAATG ACGGAACAGGAACAGGATGAACTATTTATCCTCCCTTATCCTCTAATATTTTTCATAATGGTCCTTCTGTAGACTTAACA ATTTTTTCTCTTCATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCA TAAAAATTTTTCTATTGATAAAATTCCTTTGCTCGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTAC CTGTATTAGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Formica subsericea was found to be postive for Wolbachia.
Report Inappropriate Post