Yellow Jacket (B1)

Sample information

Picture
Photos by: Drew P
Location
Collection date 09/13/2023
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

I caught the arthropod in my bedroom on the floor. It was caught in the end of summer around 68 Degrees Fahrenheit. It was crawling on the carpet. Everything looked to be normal with the insect and was probably looking for a way to escape.

Wings are a golden color, long, and look like narrow ovals. It has a hairy head/thorax, and the color of the insect is yellow and black. It also has long antennas.

Putative identification Arthropoda Insecta Hymenoptera

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction (10/04/23):

The liquid was pretty chunky, and the Yellowjacket didn’t crush up easily. The legs ripped off and the body was pretty much just flat at the end. The color of the liquid was a golden color.

PCR (October 13, 2023):

No mistakes

Gel electrophoresis, Arthropod CO1 (October 18, 2023):

There was a full band that appeared in this lane. It isn’t as bright as the other bands from other arthropods but it’s pretty bright. No mistakes were made. My DNA extraction worked because it showed up on the gel lab.

Gel electrophoresis, Wolbachia Arthropod PCR Day 2 (October 24, 2023):

Lane 1:  Ladder, Lane 2: Yellowjacket (B1), Lane 3: Spider Cricket (B2), Lane 4: Cicada (B3), Lane 5: Ladybug (B4), Lane 6: Positive Control, Lane 7: Negative Control, Lane 8: Water, Lane 9: Empty

  • No mistakes were made
  • All controls worked
  • Nothing is Wolbachia positive, besides the positive control.
  • Confidence level is high. I’m confident because the bands were not shown at all (besides the positive control) and it looked very clear meaning.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

I’m confident with B1 being negative because no trace of a band showed up on the gel. It seemed that everything worked correctly.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
NNNTNNNNTTTAGGAGCTTCnATAAGAATAATTATTCGCTTAGAATTAAGATCTCCTGGAGCCTTAATTAATAATGATCA AATTTATAATACAATTATTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTTTTTTAGTAGGAGGATTTG GAAACTGATTAATCCCTTTAATACTAGGTGTACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTACTC CCTCCTTCATTATTTTTACTAATTTTAAGAAATTTTATTGGAACAGGGGTAGGAACAGGATGAACTTTATACCCTCCTTT ATCTTCTATTGTTGGTCATGATTCTCCATCTGTAGATTTAGGAATTTTTTCAATTCATATTGCTGGAATTTCATCAATTA TAGGATCAATTAATTTTATCGTTACTATTTTAAATATACACACAAAAACACATTCATTAAATTTTCTTCCTTTATTCACA TGATCAATTTTAATTACAGCAATTCTTCTTCTATTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTTTTAACAGA TCGGAACTTAAACACATCTTTTTTCGATCCTGCAGGTGGAGGGGACCCAATTTTATATCAACATTTATTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hymenoptera was found to be negative for Wolbachia.
Report Inappropriate Post