Ontholestes SP

Sample information

Picture
Photos by: Sophia L., Precious A.
Location
Collection date 05/28/2024
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

Ontholestes SP found under dead leaves, motionless until provoked, attempted to burrow underground. Three-segmented beetle, found with one pincer missing, shiny black hard abdomen section, six legs. Yellow and brown striped patterns across abdomen and lower areas, abdomen about 3 centimeters, full body about 6 centimeters in length, pointed middle segment and “tail” like 2mm appendages at end of abdomen.

Putative identification Arthropoda Hexapoda Insecta Coleoptera Staphylinidae Ontholestes

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Ontholestes SP was identified using the SEEK app and taxonomic methods of identification. Wolbachia-rich sections of the beetle’s guts were removed from the abdomen by squeezing the abdomen. The DNA in this section was then extracted and eluted.

The gel was divided into two parts: the upper section of the gel contained results to confirm or deny the presence of Arthropoda gene CO1, while the lower section confirmed and denies presence of Wolbachia genes. both sections used positive and negative controls, DNA controls, and water controls, most of which worked properly.

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

The controls in the gel worked correctly except for the water control (suspected contamination). When blasting Arthropoda sequence, many species were identified as identical matches to the sequence, leading to a lower confidence level, thus this species will only be identified as Ontholestes.

Wolbachia 16S sequence
N/A
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
GGAATAGTAGGAACTTCCCTCAGTCTACTTATTCGAGCCGAACTTGGAAACCCTGGAACCTTAATTGGTGATGATCAAATTTATAACGTTATTGTTACAGCTCATGCATTTGTAATAATTTTCTTCATGGTAATACCAATTGTTATTGGTGGATTTGGAAATTGACTAGTACCCTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCTCTAACTCTTCTCTTAATAAGAAGAATAGCTGAAAGAGGGGCCGGAACTGGATGAACCGTTTACCCCCCTCTTTCAGCTAATGTGGCCCATAGAGGAGCTTCGGTTGATTTAGCTATTTTTAGATTACACTTAGCTGGTATCTCATCAATTCTTGGCGCAGTAAACTTTATTACTACAGTAATCAATATACGATCCACAGGAATAACATTTGATCGAATACCATTATTTGTTTGATCGGTAAGAATTACAGCTCTATTGCTTCTTTTATCCTTACCAGTTTTAGCAGGTGCTATCACTATGCTTTTAACTGATCGGAATTTAAATACAACATTTTTTGACCCTGCTGGTGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Ontholestes was found to be negative for Wolbachia.
Report Inappropriate Post