Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/12/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Walton High School |
| Observations | In moist soil, found under a bed of leaves in a foresty area. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Camponotus Camponotus pennsylvanicus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | Sample is in lane 2 in both of the gels |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
GGAACAGGAACAGGATGGACTATTTATCCTCCCTTATCCTCTAATATTTTTCATAGTGGTCCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTCGTATGATCAATTTTAATTACAGCTATCTTACTTCTATTATCCTTACCTGTATTGGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTTCGGGAGGAGGCG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Camponotus pennsylvanicus was found to be negative for Wolbachia. |



Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis