Metriocnemus fuscipes YC1

May 8, 2024

Sample information
Picture
Photos by: Yara C.
Location
Collection date 03/07/2024
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

I don’t have a photo, but i found this insect in a small forest near my school. It was under a pile of leaves. It was about 8 o’clock in the morning and the temperature was about 3 degrees celsius. I didn’t see any other Trichocera hiemalis, only the one i chaught.
Putative identification Arthropoda Hexapoda Insecta Diptera Chironomidae Metriocnemus Metriocnemus fuscipes

Methods
Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

 

The result is trustworthy, as all work steps were carried out properly and the DNA duplex worked. You can see in YC1 that no bands appeared at 438bp. Therefore it can be said that YC1 is not a Wolbachia carrier. One band appeared at 708bp. This says that YC1 is an arthropod.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
TAGGCCACGCCGGCTCTTTAATTGGAGATGACCAAATTTATAATGTAATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCGATTTTAATTGGAGGATTTGGAAATTGGCTTGTCCCTTTAATACTTGGGGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCGCCTTCTTTAACCCTACTTTTATCAAGATCCGCAGTAGAAAATGGAGCGGGCACTGGCTGAACAGTTTACCCCCCTCTATCTTCCAGAATTGCGCATGCTGGGGCATCTGTTGACCTTGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCAATCCTGGGGGCAGTAAATTTCATTACTACCATTATTAATATACGCTCAGAAAGGAATTTCATTCGACCGAATGCCTCTTTTTGTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Metriocnemus fuscipes was found to be negative for Wolbachia.
Report Inappropriate Post