Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/07/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | I don’t have a photo, but i found this insect in a small forest near my school. It was under a pile of leaves. It was about 8 o’clock in the morning and the temperature was about 3 degrees celsius. I didn’t see any other Trichocera hiemalis, only the one i chaught. |
| Putative identification | Arthropoda Insecta Diptera Chironomidae Metriocnemus Metriocnemus fuscipes |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level |
The result is trustworthy, as all work steps were carried out properly and the DNA duplex worked. You can see in YC1 that no bands appeared at 438bp. Therefore it can be said that YC1 is not a Wolbachia carrier. One band appeared at 708bp. This says that YC1 is an arthropod. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TAGGCCACGCCGGCTCTTTAATTGGAGATGACCAAATTTATAATGTAATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCGATTTTAATTGGAGGATTTGGAAATTGGCTTGTCCCTTTAATACTTGGGGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCGCCTTCTTTAACCCTACTTTTATCAAGATCCGCAGTAGAAAATGGAGCGGGCACTGGCTGAACAGTTTACCCCCCTCTATCTTCCAGAATTGCGCATGCTGGGGCATCTGTTGACCTTGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCAATCCTGGGGGCAGTAAATTTCATTACTACCATTATTAATATACGCTCAGAAAGGAATTTCATTCGACCGAATGCCTCTTTTTGTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Metriocnemus fuscipes was found to be negative for Wolbachia. |


Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis