Cylindroiulus punctatus XJ

Sample information

Picture
Entry by: Xenia J.
Location
Approximate location: 47.46, 9.02
Collection date 03/14/2024
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

Caught under the tree bark of a log in a pile of dead wood at the entrance of a forest.

Putative identification Arthropoda Diplopoda Julida Julidae Cylindroiulus Cylindroiulus punctatus

Methods

Extraction kit Instagene Matrix
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results

Wolbachia presence Yes
Confidence level Low
Explanation of confidence level

There is a band at approximately 438 base pairs. However, there is no second band at 708 base pairs, which signifies that there might have been some kind of mistake in the process. The result might be correct, if the primers simply did not catch onto the cytochromoxidase gene. (Position XJ2)

Wolbachia 16S sequence Download FASTA    Download AB1
TGGGTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGYCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGKGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGT
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary The Cylindroiulus punctatus was found to be postive for Wolbachia.
Report Inappropriate Post