Sample information |
|
Picture |
![]() |
---|---|
Location | |
Collection date | 03/14/2024 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | Caught under the tree bark of a log in a pile of dead wood at the entrance of a forest. |
Putative identification | Arthropoda Myriapoda Diplopoda Julida Julidae Cylindroiulus Cylindroiulus punctatus |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Abdomen |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
![]() |
Protocol notes | |
Results |
|
Wolbachia presence | Yes |
Confidence level | Low |
Explanation of confidence level | There is a band at approximately 438 base pairs. However, there is no second band at 708 base pairs, which signifies that there might have been some kind of mistake in the process. The result might be correct, if the primers simply did not catch onto the cytochromoxidase gene. (Position XJ2) |
Wolbachia 16S sequence | Download FASTA
Download AB1
TGGGTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGYCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGKGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGT
BLAST at The Wolbachia Project BLAST at NCBI
|
Arthropod COI sequence |
|
Summary | The Cylindroiulus punctatus was found to be postive for Wolbachia. |