Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | This Misogada unicolor is in its larva stage. It is a red color and very small. It sat in alcohol for a few days before use so it was shriveled. |
| Putative identification | Arthropoda Insecta Lepidoptera Notodontidae Misogada Misogada unicolor |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | The Misogada unicolor was placed in alcohol where it sat for 2 days. Then it was run under water for two minutes to clean it. The entire Misogada unicolor was crushed and then went through the steps of cell lysis and DNA precipitation. It was incubated for around an hour at 65 degrees C. Then the DNA was purified and eluted. After that the DNA concentration was checked. Then I started the PCR protocol. PCR was run. After PCR, I mixed a gel out of agarose, SYBER safe and running buffer. The gel was loaded and ran in a electrophoresis chamber. We read the gel for results. Then I did PCR DNA purification to send to the lab for sequencing. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | The gel results show a band at 0.7 for the COI gene in Misogada unicolor, confirming that this is an arthropod. All the controls have the expected results. The positive and negative fruit flies also have a band at 0.7, showing that they contain the COI gene and are arthropods. The water is not an arthropod, so there is no band. There is no band for Wolbachia amplification which means the Misogada unicolor was not infected with Wolbachia. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCACTAATCGGAGATGACCAAATTTACAATACTATTGTAACAGCCCATGCATTTATCATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATACTCGGGGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTATTACTCTTTTAATTTCTAGAAGAATCGTATAAAATGGGGCTGGAACTGGATGAACAGTTTACCCACCTTTATCATCTAATATTGCTCATGGGGGTAGATCAGTAGATTTAGCTATTTTTTCGCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTGTGAGCTGTANGTATTACTGCCTTTCTTTTATTATTATCTTTACCTGTTTTAGCANGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACTTCCTTTTTTGATCCTGCCGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTAN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Misogada unicolor was found to be postive for Wolbachia. |



European Paper Wasp
Woodworm Ant