Misogada unicolor larva

Sample information

Picture
Entry by: Abigail N
Location
Approximate location: 40.71, -74.55
Collection date 05/28/2024
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

This Misogada unicolor is in its larva stage. It is a red color and very small. It sat in alcohol for a few days before use so it was shriveled.

Putative identification Arthropoda Insecta Lepidoptera Notodontidae Misogada Misogada unicolor

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

The Misogada unicolor was placed in alcohol where it sat for 2 days. Then it was run under water for two minutes to clean it. The entire Misogada unicolor was crushed and then went through the steps of cell lysis and DNA precipitation. It was incubated for around an hour at 65 degrees C. Then the DNA was purified and eluted. After that the DNA concentration was checked. Then I started the PCR protocol. PCR was run. After PCR, I mixed a gel out of agarose, SYBER safe and running buffer. The gel was loaded and ran in a electrophoresis chamber. We read the gel for results.  Then I did PCR DNA purification to send to the lab for sequencing.

Results

Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

The gel results show a band at 0.7 for the COI gene in Misogada unicolor, confirming that this is an arthropod. All the controls have the expected results. The positive and negative fruit flies also have a band at 0.7, showing that they contain the COI gene and are arthropods. The water is not an arthropod, so there is no band. There is no band for Wolbachia amplification which means the Misogada unicolor was not infected with Wolbachia.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCACTAATCGGAGATGACCAAATTTACAATACTATTGTAACAGCCCATGCATTTATCATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATACTCGGGGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTATTACTCTTTTAATTTCTAGAAGAATCGTATAAAATGGGGCTGGAACTGGATGAACAGTTTACCCACCTTTATCATCTAATATTGCTCATGGGGGTAGATCAGTAGATTTAGCTATTTTTTCGCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTGTGAGCTGTANGTATTACTGCCTTTCTTTTATTATTATCTTTACCTGTTTTAGCANGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACTTCCTTTTTTGATCCTGCCGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTAN
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Misogada unicolor was found to be postive for Wolbachia.
Report Inappropriate Post