Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/30/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Specimen collected from underneath a log. The specimen is an even dark brown and has two antennae, 7 pairs of legs, and two uropods; it possesses essential characteristics of the common woodlouse, commonly referred to as a sowbug. |
| Putative identification | |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | 10-fold dilutions (20µl→ 18µl of distilled water, 2µl of original sample) were performed on template PCR due to the original DNA concentrations of the sample being too high, causing no reading on the gel. The gel submitted is the gel taken of the diluted samples, the second gel overall. |
Results |
|
| Wolbachia presence | Unknown |
| Confidence level | High |
| Explanation of confidence level | The Wolbachia portion of the gel didn’t yield any results, including the controls(the only aspect visualized on the gel was the loading buffer). The only conclusive results were sample 2 in lane 2 of the arthropod portion of the gel, as a band is clearly pictured at around 700 bp(base pairs) on the gel. In addition, the arthropod controls yielded results at around 700 bp. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GCTGTTGGAACAGCCCTTAGGATAATTATTCGAACTGAGTTAGGAAACCCTGGGAGGTTAATTGGAGACGATCAGATTTATAATGTGATTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGTAATTGATTAGTACCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGGCTTCTTCCCCCATCACTAATTTTGTTATTAAGAAGAGGTTTAGTTGAAAGAGGTGTTGGGACTGGCTGGACTGTCTACCCACCTTTGGCAAGTGGAATTGCCCATAGAGGGGCTTCAGTAGATTTAGGGATTTTTTCCCTTCATTTGGCTGGAGCTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGAGCAGAGGGGATAAGGATAGATCGTGTCCCTCTATTTGTTTGGTCAGTGTTAATTACAGCAATTCTCTTGTTACTTTCACTACCAGTTTTATCAGGGGCCATTACTATGTTATTAACAGACCGTAATCTGAACACCTCTTTTTTCGACCCTAGGGGGGGAGGAGATCCTATCTTGTACCAACACTTATTTTGATTTTTTGGTCACACAAAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1