Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/30/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | The beetle has a smooth matte black outer shell and its legs have hooks on the end. The beetle is approximately 2.5cm long and 1cm wide. We found the beetle in healthy conditions, but upon closer inspection under a dissection microscope, it looks as if the shell on the thorax may have been split into two halves after we caught the bug. |
| Putative identification | Arthropoda Insecta Coleoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | The sample extracted from the False Mealworm Beetle is in lane 4. The top half of the gel shows results for the CO1 gene, and the bottom half shows results for the 16S gene. We prepped the samples and then ran them through a gel for approximately 15 minutes at 100v. We then used a UV light to view results. The sample in Lane 4 (False Mealworm Beetle) had a band that lined up with the band from the + arthropod control, meaning our putative insect had a positive band at the CO1 arthropod gene. The sample in lane 4 (False Mealworm Beetle) did not have a band at expected + Wolbachia control band, so we feel the beetle was negative for Wolbachia infection. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | We accidentally used ladder instead of loading dye when we were preparing our samples, and as a result, our gel was a little hard to read. However, we do see a band for arthropod in lane 4 (False Mealworm Beetle). We re-ran the protocols, but our new gel only had ladder. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CCGAGCAGAGCTCGGCAATCCTGGCTCCCTTATTGGAGACGATCAAATCTACAACGTAATCGTAACCGCCCATGCATTTATCAGAATTTTCTTCATAGTTATACCAATCATAATTGGAGGTTTGGGAAATTGATTAATACCCCGAATGCTAGGAGCTCCTGACATAGCATTCCCACGAAAAAATAGCATAATATTTTGACTACTTCCCCCATCACTAACATTGTTACTAATAAGAAAAATTGGGGAAAGAGGGGCCAGAACAGGATGAACAGGTTATCCCCCCCTATCATCAAACTTTGCCCATGGTGGATCATCTGTAGATTTAGCAATTTTTACCCAACCCTTAGCAAGAATCTCTTCTATTCGAGGTGCTGTGAATTTTATTACTACAGTAATTAATATACGGCCCCAAGGAATAAGATTTGATCGAATACCNCTATTTGTATGATCAGTAATAATTACGGCCGGACTATTACTACTATCTTTACCAATACTANCANGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Coleoptera was found to be negative for Wolbachia. |



Potter’s grass spider (Agelenopsis Potteri)
Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)